pLV-UbC-Tet1v4-dCas9
(Plasmid #232180)

• Purpose: Tet1v4-dCas9 from Nuñez et al. 2021, in a lentiviral cassette with blasticidin resistance, for expression in mammalian cells
• Depositing Lab: Charles Gersbach
• Publication: Rohm et al Cell Genom. 2025 Feb 12;5(2):100770. doi: 10.1016/j.xgen.2025.100770.

Backbone

• Vector backbone: FUGW
• Backbone size w/o insert (bp): 7000
• Total vector size (bp): 16300
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Tet1 catalytic domain - XTEN80 linker - dead Cas9 - 2A - BlastR
• Alt name: TET1 catalytic domain
• Species: H. sapiens (human); S. pyogenes
• Insert Size (bp): 4100
• Mutation: D10A, H840A
• Entrez Gene: TET1 (a.k.a. CXXC6, LCX, bA119F7.1)
• Promoter: hUbC
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aagttttttaggcaccttttgaaatg

Resource Information

• Supplemental Documents:
  • pDFR053-consensus_annotation.gbk
• A portion of this plasmid was derived from a plasmid made by: Tet1-XTEN80-dCas9 sequence from Addgene plasmid #167983 was amplified for insertion into lentiviral expression vector containing BSD

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2024.03.03.583177 for bioRxiv preprint.