Skip to main content
Addgene

pET28-NFMtail
(Plasmid #232056)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232056 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET28a
  • Backbone size w/o insert (bp) 5200
  • Total vector size (bp) 6600
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Neurofilament-Medium tail domain
  • Alt name
    NFM tail
  • Species
    R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    1400
  • Mutation
    cDNA codon-optimized for E. coli; added N-terminal tryptophan and tyrosine, and cysteine for surface grafting
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis, thrombin (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28-NFMtail was a gift from Sanjay Kumar (Addgene plasmid # 232056 ; http://n2t.net/addgene:232056 ; RRID:Addgene_232056)

  • For your References section:

    Dissecting neurofilament tail sequence-phosphorylation-structure relationships with multicomponent reconstituted protein brushes. Ding EA, Yokokura TJ, Wang R, Kumar S. Proc Natl Acad Sci U S A. 2024 Dec 3;121(49):e2410109121. doi: 10.1073/pnas.2410109121. Epub 2024 Nov 27. 10.1073/pnas.2410109121 PubMed 39602260
Related items: