pHD-FlpTag-DsRed-HDR-ph1
(Plasmid #231901)

• Purpose: dsDNA donor vector with 3xP3-DsRed and FlpTag-GFP for precise genomic targeting and integration of the FlpTag-GFP cassette with codon phase 1.
• Depositing Lab: Alexander Borst
• Publication: Fendl et al Elife. 2020 Oct 20;9:e62953. doi: 10.7554/eLife.62953.

Backbone

• Vector backbone: pHD-DsRed
• Backbone manufacturer: Kate O'Connor-Giles
• Backbone size w/o insert (bp): 4048
• Total vector size (bp): 5103
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Frt-Frt14-SD-GFP-SA-Frt-Frt14
• Species: Synthetic
• Insert Size (bp): 1352

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TGTAAAACGACGGCCAGT
• 3′ sequencing primer: ATGGCTCATAACACCCCTTG

Resource Information

• Supplemental Documents:
  • pHD-FlpTag-DsRed-HDR-ph1.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The FlpTag insertion consists of an inverted sequence containing a splice acceptor (SA), GFP, and a splice donor (SD), flanked on either side by FRT and FRT14 recombination sites. This configuration allows conditional protein tagging, where the cassette orientation is controlled by Flp recombinase, enabling specific expression of GFP in targeted cells or tissues.