pLentiCRISPRpuro-sgSEC24C #1
(Plasmid
#231563)
-
PurposepLentiCRISPR expression vector for Cas9 and gRNA targeting human SEC24C (#1) (Puromycin selection marker)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 231563 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLentiCRISPR-Puro
- Backbone size w/o insert (bp) 13000
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgSEC24C #1
-
gRNA/shRNA sequenceAAGAGCCCCACCTTCCTCGG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GeneSEC24C
- Promoter U6, EF-1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer LKO.1 (Forward)
- 3′ sequencing primer WPRE (Reverse) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPRpuro-sgSEC24C #1 was a gift from Rizwan Haq (Addgene plasmid # 231563 ; http://n2t.net/addgene:231563 ; RRID:Addgene_231563) -
For your References section:
Genomic mediators of acquired resistance to immunotherapy in metastatic melanoma. Schiantarelli J, Benamar M, Park J, Sax HE, Oliveira G, Bosma-Moody A, Campbell KM, Liu D, Johnson DB, Rodig S, Wu CJ, Hodi FS, Ribas A, Van Allen E, Haq R. Cancer Cell. 2025 Feb 10;43(2):308-316.e6. doi: 10.1016/j.ccell.2025.01.009. 10.1016/j.ccell.2025.01.009 PubMed 39933900