pLANT-2b
(Plasmid #231487)

• Purpose: Expresses His6-SUMO^NIT-FraB where "NIT" stands for "no internal translation", reflecting the mutation of the two Shine-Dalgarno-like sequences within the SUMO tag.
• Depositing Lab: Venkat Gopalan
• Publication: Design of a yeast SUMO tag to eliminate internal translation initiation (unpublished)

Backbone

• Vector backbone: pLANT-2b
• Backbone size w/o insert (bp): 4665
• Total vector size (bp): 5937
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: SUMO^NIT
• Alt name: Small ubiquitin-like modifier
• Alt name: Smt3
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 294
• Mutation: M83L, E84Q, D85N, G97A, G98G (synonymous mutation)
• Entrez Gene: SMT3 (a.k.a. YDR510W)
• Promoter: T7 promoter
• Tag / Fusion Protein:
  • His6 tag (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: taatacgactcactataggggaattgtg
• 3′ sequencing primer: gctagttattgctcagcgg

Gene/Insert 2

• Gene/Insert name: FraB
• Alt name: 6-phosphofructose aspartate deglycase
• Species: Salmonella enterica subsp. enterica serovar Typhimurium
• Insert Size (bp): 978
• Mutation: Deleted amino acids 1-6 (MEPEES).
• GenBank ID: CP026700.1
• Promoter: T7 promoter
• Tag / Fusion Protein:
  • His6-SUMO^NIT

Cloning Information for Gene/Insert 2

• Cloning method: Other
• 5′ sequencing primer: taatacgactcactataggggaattgtg
• 3′ sequencing primer: gctagttattgctcagcgg

Resource Information

• Supplemental Documents:
  • pLANT-2b + His6-SUMO^NIT-FraB.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry