pAAV-hSyn-spCas9
(Plasmid
#231404)
-
PurposeExpresses spCas9 from hSyn promoter
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231404 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehSYN promoter
-
SpeciesH. sapiens (human)
-
Entrez GeneRIC8B (a.k.a. RIC8, hSyn)
- Promoter hSYN
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba1 (not destroyed)
- 3′ cloning site Age (not destroyed)
- 5′ sequencing primer cctctagaagtgcaagtggg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Replaced RSV promoter in Plasmid #85450 from Lei lab with hSyn promoter.
Please visit https://doi.org/10.1101/2024.07.15.603543 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-spCas9 was a gift from Arjen Boender & Larry Young (Addgene plasmid # 231404 ; http://n2t.net/addgene:231404 ; RRID:Addgene_231404) -
For your References section:
Oxytocin facilitates social behavior of female rats via selective modulation of interneurons in the medial prefrontal cortex. Schimmer S, Kania A, Lefevre A, Afordakos K, Wang KY, Lebedeva J, Rozov A, Raftogianni A, Tiwari R, Netser S, Zovko A, Shaheen H, Schimmer J, Patwell R, Denis C, Grelot V, Petitjean H, Geng L, Hefter D, Boender A, Podpecan Y, Schommer F, Schubert T, Sanetra A, Trenk A, Gugula A, Hurlemann R, Wagner S, Li Y, Althammer F, Blasiak A, Melzer S, Monyer H, Charlet A, Eliava M, Grinevich V. Nat Commun. 2026 Feb 20;17(1):1932. doi: 10.1038/s41467-026-68347-x. 10.1038/s41467-026-68347-x PubMed 41720765