Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHR'CMVGFP_hRIF1(1355-2446)IREShygro
(Plasmid #23136)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 23136 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHR'CMVGFPIREShygro_WSIN18
  • Backbone manufacturer
    Didier Trono Lab
  • Backbone size w/o insert (bp) 10000
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Grow in DH5a @ 30C
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RIF1 deletion construct
  • Alt name
    GFP_hRIF1(1355-2446)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4125
  • Entrez Gene
    RIF1
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CAGAGCTCGTTTAGTGAACCGTCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Backbone vector sequence is only approximated. Please contact the Trono lab for full vector sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR'CMVGFP_hRIF1(1355-2446)IREShygro was a gift from Lifeng Xu (Addgene plasmid # 23136 ; http://n2t.net/addgene:23136 ; RRID:Addgene_23136)
  • For your References section:

    Human Rif1 protein binds aberrant telomeres and aligns along anaphase midzone microtubules. Xu L, Blackburn EH. J Cell Biol. 2004 Dec 6. 167(5):819-30. 10.1083/jcb.200408181 PubMed 15583028