pcDNA5 FRT TO GFP11-LRRK2_G2019S
(Plasmid
#231175)
-
PurposeExpresses GFP-11-LRRK2 G2019S in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 231175 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA5
- Backbone size w/o insert (bp) 5082
- Total vector size (bp) 12729
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP11-LRRK2 (G2019S)
-
Alt nameLRRK2 (G2019S)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7647
-
MutationG2019S
-
Entrez GeneLRRK2 (a.k.a. AURA17, DARDARIN, PARK8, RIPK7, ROCO2)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP11 (N terminal on insert)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGenScript Gene Synthesis
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5 FRT TO GFP11-LRRK2_G2019S was a gift from Samara Reck-Peterson (Addgene plasmid # 231175 ; http://n2t.net/addgene:231175 ; RRID:Addgene_231175) -
For your References section:
Type-II kinase inhibitors that target Parkinson's Disease-associated LRRK2. Raig ND, Surridge KJ, Sanz-Murillo M, Dederer V, Kramer A, Schwalm MP, Elson L, Chatterjee D, Mathea S, Hanke T, Leschziner AE, Reck-Peterson SL, Knapp S. bioRxiv [Preprint]. 2025 Feb 13:2024.09.17.613365. doi: 10.1101/2024.09.17.613365. 10.1101/2024.09.17.613365 PubMed 39554022