pMX222
(Plasmid
#23109)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 23109 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4709
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMitotic Centromere Associated Kinesin
-
Alt nameMCAK
-
Alt nameKif2C
-
Alt nameKinesin 13
-
SpeciesCricetulus griseus (Chinese hamster)
-
Insert Size (bp)2238
-
MutationS92E, S106E, S108E, S112E, S186E
-
GenBank IDU11790
-
Tags
/ Fusion Proteins
- GFP (N terminal on backbone)
- His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspEI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer catggtcctgctggagttcgtg
- 3′ sequencing primer TTTTAAAGCAAGTAAAACCTCTACAAA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMX222 was a gift from Linda Wordeman (Addgene plasmid # 23109 ; http://n2t.net/addgene:23109 ; RRID:Addgene_23109) -
For your References section:
Aurora B regulates MCAK at the mitotic centromere. Andrews PD, Ovechkina Y, Morrice N, Wagenbach M, Duncan K, Wordeman L, Swedlow JR. Dev Cell. 2004 Feb . 6(2):253-68. 10.1016/S1534-5807(04)00025-5 PubMed 14960279