Skip to main content
Addgene

pRSFDuet-1 ElonginB, ElonginC
(Plasmid #230999)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 230999 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pRSF Duet-1
  • Backbone manufacturer
    Sigma-Aldrich
  • Backbone size w/o insert (bp) 3829
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Elongin B
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    357
  • Entrez Gene
    Elob (a.k.a. 0610040H15Rik, Tceb2)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site Sal1 (unknown if destroyed)
  • 5′ sequencing primer GGATCTCGACGCTCTCCC
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Elongin C
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    337
  • Entrez Gene
    Eloc (a.k.a. 2610043E24Rik, 2610301I15Rik, Tceb1)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer GCTAGTTATTGCTCAGCGGT
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSFDuet-1 ElonginB, ElonginC was a gift from Michael Rape (Addgene plasmid # 230999 ; http://n2t.net/addgene:230999 ; RRID:Addgene_230999)

  • For your References section:

    A Cellular Mechanism to Detect and Alleviate Reductive Stress. Manford AG, Rodriguez-Perez F, Shih KY, Shi Z, Berdan CA, Choe M, Titov DV, Nomura DK, Rape M. Cell. 2020 Oct 1;183(1):46-61.e21. doi: 10.1016/j.cell.2020.08.034. Epub 2020 Sep 16. 10.1016/j.cell.2020.08.034 PubMed 32941802
Related items: