pDUP 4-1
(Plasmid #23022)

• Depositing Lab: Douglas Black
• Publication: Modafferi et al Mol Cell Biol. 1997 Nov . 17(11):6537-45.

Backbone

• Vector backbone: DUP33
• Backbone manufacturer: Z Dominski and R Kole
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: c-src
• Species: M. musculus (mouse)
• Entrez Gene: Src (a.k.a. pp60c-src)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NsiI (not destroyed)
• 3′ cloning site: DraIII (not destroyed)
• 5′ sequencing primer: CMV-F

Resource Information

• Supplemental Documents:
  • pDUP4-1.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This clone was assembled from multiple PCR products by using the following
primers, described by their sequence relationship to the transcribed DUP RNA.
DUP1 (GCAGCTCACTCAGTGTGGCA) is complementary to CMV DUP33
exon 3 (globin exon 2). DUP2 (CCAATAGATCTGGGCATGTG) is homolo-
gous to CMV DUP33 intron 2 but with an inserted BglII site. DUP3 (CACAT
GCCCAGATCTATTGG) is complementary to intron 2 and to primer DUP2
and also contains the BglII site. DUP4 (GCTGCTGGTGGTGCCATGGC) is
homologous to CMV DUP33 exon 2. DUP5 (CTGCCCAGGGCCTGCCAT
GG) is complementary to CMV DUP33 exon 2 and to primer DUP4. DUP6
(TTCTGATAGGGCCCACTGACTCT) is homologous to CMV DUP33 intron
1 but contains an inserted ApaI site. DUP7 (AGAGTCAGTGGGCCCTATCA
GAA) also contains the ApaI site and is complementary to intron 1 and primer
DUP6. DUP8 (GACACCATGCATGGTGCACC) is homologous to DUP exon
1. A series of PCRs was performed with the following primers and templates.
Fragments of CMV DUP33 DNA were amplified by using primer pairs 1-2, 3-4,
5-6, and 7-8. The second set of PCRs used the following: primers 1 and 4 with the
1-2 and 3-4 PCR products as templates, and primers 5 and 8 with the 5-6 and 7-8
PCR products as templates. A final PCR assembled a complete fragment by
using primers 1 and 8 with the 1-4 and 5-8 PCR products as templates. This final
PCR product was cleaved with NsiI and DraIII and inserted into the CMV
DUP33 vector also cleaved with NsiI and DraIII. This clone was designated
DUP4-1.