pCAG-GluA2-Fab-LC
(Plasmid
#230063)
-
PurposeExpresses light chain Fab fragment of anti-GluA2. Can be used with heavy chain to produce Fab in HEK cells.
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 230063 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4625
- Total vector size (bp) 5550
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAnti-GluA2 Fab light chain fragment
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)796
- Promoter Chicken beta actin (CAG)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tagagcctctgctaaccatg
- 3′ sequencing primer acgcacaccggccttat (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-GluA2-Fab-LC was a gift from Matthew Kennedy (Addgene plasmid # 230063 ; http://n2t.net/addgene:230063 ; RRID:Addgene_230063)