Skip to main content
Addgene

fabp10a:FLAG-SpiCee-mRFP1; cryaa:mCherry
(Plasmid #230062)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 230062 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBlueScript
  • Vector type
    Zebrafish Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpiCee
  • Species
    Synthetic
  • Insert Size (bp)
    597
  • Promoter fabp10a
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • mRFP1 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer gtcgtcaaatcctggtgcaa
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Xavier Nicol. SpiCee-mRFP1 obtained from pCX-SpiCee (Addgene Plasmid #140836).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    fabp10a:FLAG-SpiCee-mRFP1; cryaa:mCherry was a gift from Sumeet Pal Singh (Addgene plasmid # 230062 ; http://n2t.net/addgene:230062 ; RRID:Addgene_230062)
  • For your References section:

    In vivo imaging of calcium dynamics in zebrafish hepatocytes. Pozo-Morales M, Garteizgogeascoa I, Perazzolo C, So J, Shin D, Singh SP. Hepatology. 2023 Mar 1;77(3):789-801. doi: 10.1002/hep.32663. Epub 2023 Feb 17. 10.1002/hep.32663 PubMed 35829917