pCAG-GluA2-scFv-Halo-HRV-BiotinAP-HIS
(Plasmid
#230059)
-
PurposeExpresses a single chain variable fragment (scFv) for anti-GluA2 fused to Halotag with an HRV (PreScission) protease cleavage site, biotin acceptor peptide and 6XHIS purification tag.
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 230059 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4625
- Total vector size (bp) 6688
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAnti-GluA2 single chain variable fragment (scFv)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1914
- Promoter Chicken beta actin (CAG)
-
Tags
/ Fusion Proteins
- HaloTag (C terminal on insert)
- HRV 3C PreScission protease (C terminal on insert)
- biotinylation acceptor peptide (C terminal on insert)
- 6X HIS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tagagcctctgctaaccatg
- 3′ sequencing primer acgcacaccggccttat (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-GluA2-scFv-Halo-HRV-BiotinAP-HIS was a gift from Matthew Kennedy (Addgene plasmid # 230059 ; http://n2t.net/addgene:230059 ; RRID:Addgene_230059)
