TB205 △trpC
(Bacterial strain
#230038)
-
PurposeFluorescently labelled (mCherry) E. coli, auxotrophic for tryptophan
-
Depositing Labs
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Bacterial Strain | 230038 | Bacteria in agar stab | 1 | $85 |
Backbone
-
Vector backboneNA
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)None
-
Growth Temperature37°C
-
Growth Strain(s)TB205
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMG1655 attP21::PR-mCherry::frt trpC::frt
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Strain Validation: Fluorescence, growth in M9+glucose +/- tryptophane, PCRs with primers flanking fluorescent marker gene or deleted gene.
Primers:
trpC_fwd: AACGTCGCCATGTTAATGCG
trpC_rev: GAACTGAGCCTGAAATTCAGG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TB205 △trpC was a gift from Martin Ackermann & Olga Schubert (Addgene plasmid # 230038) -
For your References section:
Short-range interactions govern the dynamics and functions of microbial communities. Dal Co A, van Vliet S, Kiviet DJ, Schlegel S, Ackermann M. Nat Ecol Evol. 2020 Mar;4(3):366-375. doi: 10.1038/s41559-019-1080-2. Epub 2020 Feb 10. 10.1038/s41559-019-1080-2 PubMed 32042125