pDF1b-iRGP
(Plasmid #229978)

• Purpose: Rhamnose inducible expression of Rhodotorula glutinis RgPAL gene
• Depositing Lab: Christie Peebles
• Publication: Hunstiger et al Biotechnol. Prog. 2024;e3512.

Backbone

• Vector backbone: pDF1b
• Backbone size w/o insert (bp): 7861
• Total vector size (bp): 11102
• Modifications to backbone: y25f mobA mutation at 5574-5575 Mutated site in mobA gene with inactivated nickase activity to increase transformation efficiency, based on: Bishe B, Taton A, Golden JW. Modification of RSF1010-Based Broad-Host-Range Plasmids for Improved Conjugation and Cyanobacterial Bioprospecting. iScience. 2019;20:216-228.doi:10.1016/j.isci.2019.09.002
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Prha Rhamnose Inducible Promoter
• Species: Synthetic
• Insert Size (bp): 1099
• Promoter: n/a

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ttattgcagaaagccatc
• 3′ sequencing primer: ttctacctcctttgtatattataaac

Gene/Insert 2

• Gene/Insert name: Rhodotorula glutinis RgPAL
• Species: Rhodotorula glutinis
• Insert Size (bp): 2142
• Promoter: Prha

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: atggcacctagcgttgac
• 3′ sequencing primer: ctaggccatcatcttgactaatac

Resource Information

• Supplemental Documents:
  • pDF1b-iRGP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

Twenty-six initial pDF plasmids were generously shared with us by the lab of Dr. Paulo Kallio. Dr. Jacob Sebesta generated the initial pDF1b backbone used in this study.

The Prha rhamnose inducible promoter was synthesized based on:
Kelly CL, Taylor GM, Hitchcock A, Torres-Méndez A, Heap JT. A Rhamnose-inducible system for precise and temporal control of gene expression in cyanobacteria. ACS Synth Biol. 2018;7(4):1056-1066. doi:10.1021/acssynbio.7b00435