Skip to main content
Addgene

pDF1b-iNTP
(Plasmid #229977)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 229977 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pDF1b
  • Backbone size w/o insert (bp) 7861
  • Total vector size (bp) 11114
  • Modifications to backbone
    y25f mobA mutation at 4770-4771 Mutated site in mobA gene with inactivated nickase activity to increase transformation efficiency, based on: Bishe B, Taton A, Golden JW. Modification of RSF1010-Based Broad-Host-Range Plasmids for Improved Conjugation and Cyanobacterial Bioprospecting. iScience. 2019;20:216-228.doi:10.1016/j.isci.2019.09.002
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Prha Rhamnose Inducible Promoter
  • Species
    Synthetic
  • Insert Size (bp)
    1099
  • Promoter n/a

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ttattgcagaaagccatc
  • 3′ sequencing primer ttctacctcctttgtatattataaac
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Nicotiana tabacum PAL 4
  • Species
    Nicotiana tabacum
  • Insert Size (bp)
    2154
  • Promoter Prha

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atggcaagcaatggtcatg
  • 3′ sequencing primer ttaacagatcggtagaggc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Twenty-six initial pDF plasmids were generously shared with us by the lab of Dr. Paulo Kallio. Dr. Jacob Sebesta generated the initial pDF1b backbone used in this study.

The Prha rhamnose inducible promoter was synthesized based on:
Kelly CL, Taylor GM, Hitchcock A, Torres-Méndez A, Heap JT. A Rhamnose-inducible system for precise and temporal control of gene expression in cyanobacteria. ACS Synth Biol. 2018;7(4):1056-1066. doi:10.1021/acssynbio.7b00435

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDF1b-iNTP was a gift from Christie Peebles (Addgene plasmid # 229977 ; http://n2t.net/addgene:229977 ; RRID:Addgene_229977)
  • For your References section:

    Improving trans-cinnamic acid production in a model cyanobacterium. Hunstiger D, Ma H, Paton AJ, Peebles CAM. Biotechnol. Prog. 2024;e3512. 10.1002/btpr.3512