pSpCas9 (BB)-2A-GFP-RB1sg
(Plasmid
#229857)
-
Purposesingle guide RNA targeting human RB1 gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 229857 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSpCas9 (BB)-2A-GFP
-
Backbone manufacturerDr. Zhang
- Backbone size w/o insert (bp) 9289
- Total vector size (bp) 9309
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRB1sgRNA
-
Alt nameRB1
-
gRNA/shRNA sequenceCCGAAAAACGGCCGCCACCG
-
SpeciesH. sapiens (human)
-
Entrez GeneRB1 (a.k.a. OSRC, PPP1R130, RB, p105-Rb, p110-RB1, pRb, pp110)
-
Tag
/ Fusion Protein
- The gamma-tubulin sgRNA is coexpressed with 3xFLAG-Cas9-GFP
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9 (BB)-2A-GFP-RB1sg was a gift from Maria Alvarado-Kristensson (Addgene plasmid # 229857 ; http://n2t.net/addgene:229857 ; RRID:Addgene_229857) -
For your References section:
Targeting TUBG1 in RB1-negative tumors. Lindstrom L, Zhou J, Villoutreix BO, Malycheva D, Otrocka M, Gustavsson AL, Lundback T, Bliman D, Shameem MA, Straw M, Riesbeck K, Olsson R, Alvarado-Kristensson M. FASEB J. 2025 Mar 15;39(5):e70431. doi: 10.1096/fj.202403180RR. 10.1096/fj.202403180RR PubMed 40019206