pcDNA3.1 Flag-TUBG2
(Plasmid #229855)

• Purpose: TUBG2
• Depositing Lab: Maria Alvarado-Kristensson
• Publication: Lindstrom et al FASEB J. 2025 Mar 15;39(5):e70431. doi: 10.1096/fj.202403180RR.

Backbone

• Vector backbone: pcDNA3.1
• Backbone manufacturer: thermofisher
• Backbone size w/o insert (bp): 5428
• Total vector size (bp): 6784
• Modifications to backbone: The flag-tag was inserted in the pcDNA3-TUBG2 (Addgene plasmid 171966) vector using a Quikchange Mutagenesis Kit (Stratagene) with the following oligos: 5’TGGAATTCACCATGGATTACAAGGATGACGACGATAAGATCCCCCGGGA GATCAT3’ and 5’ATGATCTCCCGGGGGATCTTATCGTCGTCATCCTTGTA ATCCATGGTGAATTCCA3’.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TUBG2
• Species: H. sapiens (human)
• Insert Size (bp): 1356
• Mutation: Removal of the internal TUBG2-EcoRI site by changing the nucleotide from A to G at position 117.
• GenBank ID: NM_016437.3
• Entrez Gene: TUBG2
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: mCherry tagged TUBG2/pReceiver-M56 was purchased from GeneCopeia, Rockville, USA.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The internal EcoRI was removed from the GeneCopeia mCherry tagged TUBG2/pReceiver-M56 plasmid and TUBG2 was sub-cloned into pcDNA3.1, and a Flag was added to the N-terminal region of TUBG2.

To create a TUBG2 gene resistant to human pTER gamma-tubulin shRNA (Addgene plasmid #87955) and single guide RNA TUBG2, the following silent mutations have been introduced:

G to A at position 30
C to A at position 33
C to T at position 1236
C to T at position 1242