Skip to main content
Addgene

PX459-CTNNA1(α-catenin CRISPR KO)
(Plasmid #229708)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 229708 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    PX459
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid #62988)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CTNNA1 (alpha-catenin) Human
  • Alt name
    MDBS2; MDPT2; CAP102
  • gRNA/shRNA sequence
    GAAATGACTGCTGTCCATGC
  • Species
    H. sapiens (human)
  • Entrez Gene
    CTNNA1 (a.k.a. CAP102, MDBS2, MDPT2)
  • Promoter CMV promoter

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX459-CTNNA1(α-catenin CRISPR KO) was a gift from Alpha Yap (Addgene plasmid # 229708 ; http://n2t.net/addgene:229708 ; RRID:Addgene_229708)

  • For your References section:

    An E-cadherin-actin clutch translates the mechanical force of cortical flow for cell-cell contact to inhibit epithelial cell locomotion. Noordstra I, Hermoso MD, Schimmel L, Bonfim-Melo A, Currin-Ross D, Duong CN, Kalappurakkal JM, Morris RG, Vestweber D, Mayor S, Gordon E, Roca-Cusachs P, Yap AS. Dev Cell. 2023 Sep 25;58(18):1748-1763.e6. doi: 10.1016/j.devcel.2023.06.011. Epub 2023 Jul 21. 10.1016/j.devcel.2023.06.011 PubMed 37480844
Related items: