Skip to main content
Addgene

pcDNA3.1(-)-EGFP-AP4-mito
(Plasmid #229693)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 229693 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA 3.1(-)
  • Backbone size w/o insert (bp) 5401
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP; Control construct with tandem AP4 motifs (mitochondria)
  • Species
    Listeria monocytogenes
  • Insert Size (bp)
    1875
  • Promoter CMV promoter
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer T7 Forward; TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(-)-EGFP-AP4-mito was a gift from Alpha Yap (Addgene plasmid # 229693 ; http://n2t.net/addgene:229693 ; RRID:Addgene_229693)
  • For your References section:

    Ena/VASP proteins can regulate distinct modes of actin organization at cadherin-adhesive contacts. Scott JA, Shewan AM, den Elzen NR, Loureiro JJ, Gertler FB, Yap AS. Mol Biol Cell. 2006 Mar;17(3):1085-95. doi: 10.1091/mbc.e05-07-0644. Epub 2005 Dec 21. 10.1091/mbc.e05-07-0644 PubMed 16371509