pLEX Myc-HA
(Plasmid
#229499)
-
PurposeFor lentiviral expression of Myc coding sequence with an HA tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 229499 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLEX
-
Backbone manufacturerTakara
- Total vector size (bp) 11979
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMYC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1344
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNA sequences were obtained from Horizon Discovery Biosciences Ltd. (MHS6278-202755482 )
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEX Myc-HA was a gift from Davide Ruggero (Addgene plasmid # 229499 ; http://n2t.net/addgene:229499 ; RRID:Addgene_229499) -
For your References section:
Functional screen identifies RBM42 as a mediator of oncogenic mRNA translation specificity. Kovalski JR, Sarioglu G, Subramanyam V, Hernandez G, Rademaker G, Oses-Prieto JA, Slota M, Mohan N, Yiakis K, Liu I, Wen KW, Kim GE, Miglani S, Burlingame AL, Goodarzi H, Perera RM, Ruggero D. Nat Cell Biol. 2025 Feb 4. doi: 10.1038/s41556-024-01604-7. 10.1038/s41556-024-01604-7 PubMed 39905246