Skip to main content
Addgene

sgCDK1-ROSA
(Plasmid #229443)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 229443 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    LentiVi
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin ; GFP-P2A-BlastR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgCDK1-ROSA
  • gRNA/shRNA sequence
    ACACAATCCCCTGTAGGATT;TTGCGGTCAGGTCACGCCGC
  • Species
    H. sapiens (human)
  • Entrez Gene
    CDK1 (a.k.a. CDC2, CDC28A, P34CDC2)
  • Promoter hU6;bU6;EFS

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgCDK1-ROSA was a gift from Christopher Vakoc (Addgene plasmid # 229443 ; http://n2t.net/addgene:229443 ; RRID:Addgene_229443)
  • For your References section:

    MARK2/MARK3 kinases are catalytic co-dependencies of YAP/TAZ in human cancer. Klingbeil O, Skopelitis D, Tonelli C, Yoshimoto T, Alpsoy A, Panepinto MC, Minicozzi F, Merrill JR, Cafiero AM, Aggarwal D, Russo S, Ha T, Demerdash OE, Wee TL, Spector DL, Lyons SK, Tuveson DA, Cifani P, Vakoc CR. Cancer Discov. 2024 Jul 26. doi: 10.1158/2159-8290.CD-23-1529. 10.1158/2159-8290.CD-23-1529 PubMed 39058094