pFA6a-FLAG-APEX2-NES-TRP1
(Plasmid
#229228)
-
Purpose(Empty Backbone) Template plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeast
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 229228 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFA6a
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CGTACGCTGCAGGTCGACGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFA6a-FLAG-APEX2-NES-TRP1 was a gift from Fulvio Reggiori (Addgene plasmid # 229228 ; http://n2t.net/addgene:229228 ; RRID:Addgene_229228) -
For your References section:
An APEX2-based proximity-dependent biotinylation assay with temporal specificity to study protein interactions during autophagy in the yeast Saccharomyces cerevisiae. Filali-Mouncef Y, Leytens A, Vargas Duarte P, Zampieri M, Dengjel J, Reggiori F. Autophagy. 2024 Oct;20(10):2323-2337. doi: 10.1080/15548627.2024.2366749. Epub 2024 Jul 3. 10.1080/15548627.2024.2366749 PubMed 38958087