Skip to main content
Addgene

E547* FL USP7
(Plasmid #229001)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 229001 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET28a-LIC
  • Backbone manufacturer
    Structural Genomics Consortium, Toronto
  • Backbone size w/o insert (bp) 7328
  • Total vector size (bp) 10634
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    USP7 1-546
  • Alt name
    Ubiquitin carboxyl-terminal hydrolase 7
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3306
  • Mutation
    E547 mutated to stop codon
  • Entrez Gene
    USP7 (a.k.a. C16DELp13.2, DEL16P13.2, HAFOUS, HAUSP, TEF1)
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis cleavable with thrombin (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer T7 5’ AATTAATACGACTCACTATAGGG 3’
  • 3′ sequencing primer T7-term 5’ ATGCTAGTTATTGCTCAGCGG 3’
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    E547* FL USP7 was a gift from Irina Bezsonova (Addgene plasmid # 229001 ; http://n2t.net/addgene:229001 ; RRID:Addgene_229001)
Related items: