pCEFL-EGFP-TEADiv2
(Plasmid
#228872)
-
PurposeExpression of optimized TEAD inhibitor (TEADiv2): GFP-tagged inhibitor of the interaction of YAP1 and TAZ with TEAD transcription factors with nuclear localization signal
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 228872 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCEFL
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTEADiv2
-
Alt nameTEAD dominant-negative inhibitor GFP tagged
-
SpeciesH. sapiens (human)
-
Insert Size (bp)321
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TTCTTCCATTTCAGGTGTCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
GFP-tagged inhibitor of the interaction of YAP1 and TAZ with TEAD transcription factors with nuclear localization signal. Optimized by a D93E mutation in the YAP1 TBD with respect to original TEADi (Addgene #140144). As with other dominant negative proteins, good levels of expression are necessary for TEADi to block TEADs.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCEFL-EGFP-TEADiv2 was a gift from Ramiro Iglesias-Bartolome (Addgene plasmid # 228872 ; http://n2t.net/addgene:228872 ; RRID:Addgene_228872) -
For your References section:
An improved TEAD dominant-negative protein inhibitor to study Hippo YAP1/TAZ-dependent transcription. Branch B, Yuan Y, Cascone M, Raimondi F, Iglesias-Bartolome R. bioRxiv [Preprint]. 2024 Oct 3:2024.10.03.615022. doi: 10.1101/2024.10.03.615022. 10.1101/2024.10.03.615022 PubMed 39502361