Skip to main content
Addgene

EHMT1_exon 3_gRNA
(Plasmid #228809)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228809 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-GFP
  • Backbone manufacturer
    Feng Zhang (Addgene # 48138)
  • Backbone size w/o insert (bp) 9300
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA targeting EHMT1 exon 3
  • gRNA/shRNA sequence
    GCGCCGACGTCAAGGTCCACA
  • Species
    H. sapiens (human)
  • Entrez Gene
    EHMT1 (a.k.a. EHMT1-IT1, EUHMTASE1, Eu-HMTase1, FP13812, GLP, GLP1, KLEFS1, KMT1D)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.11.01.564969 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EHMT1_exon 3_gRNA was a gift from Shravanti Rampalli (Addgene plasmid # 228809 ; http://n2t.net/addgene:228809 ; RRID:Addgene_228809)
  • For your References section:

    A cytoplasmic form of EHMT1N methylates viral proteins to enable inclusion body maturation and efficient viral replication. Biligiri KK, Sharma NR, Mohanty A, Sarkar DP, Vemula PK, Rampalli S.. PLOS Biology 22(11): e3002871. 10.1371/journal.pbio.3002871