pCJ1023
(Plasmid #228763)

• Purpose: Plasmid expressing Cas9 and gRNAs for mouse Ift88 and Pkd2. Use for disruption of mouse Ift88 and Pkd2 in cultured cells.
• Depositing Lab: Bradley Yoder
• Publication: Plasmid expressing Cas9 and 2 gRNAs for mouse Pkd2 and Ift88 (unpublished)

Backbone

• Vector backbone: pSpCas9(BB)-2A-GFP (PX458)
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 9300
• Total vector size (bp): 9644
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ift88 and Pkd2 gRNAs
• gRNA/shRNA sequence: Ift88 gRNA: tcaatgggaagaccgatgac; Pkd2 gRNA: acgcacgcagttccattccg
• Species: M. musculus (mouse)
• Entrez Gene: Ift88 (a.k.a. Tg737, Tg737Rpw, TgN737Rpw, Ttc10, flexo, fxo, orpk, polaris)
• Entrez Gene: Pkd2 (a.k.a. C030034P18Rik, PC2, TRPP2)
• Promoter: human U6
• Tags / Fusion Proteins:
  • 3XFLAG (N terminal on backbone)
  • GFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: SapI (destroyed during cloning)
• 5′ sequencing primer: agcgcgtgcgccaattctgcagacaaatggc
• 3′ sequencing primer: gccatttgtctgcagaattggcgcacgcgct

Resource Information

• Supplemental Documents:
  • pcj1023.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry