Skip to main content
Addgene

pCJ1023
(Plasmid #228763)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228763 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-GFP (PX458)
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 9300
  • Total vector size (bp) 9644
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ift88 and Pkd2 gRNAs
  • gRNA/shRNA sequence
    Ift88 gRNA: tcaatgggaagaccgatgac; Pkd2 gRNA: acgcacgcagttccattccg
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Ift88 (a.k.a. Tg737, Tg737Rpw, TgN737Rpw, Ttc10, flexo, fxo, orpk, polaris)
  • Entrez Gene
    Pkd2 (a.k.a. C030034P18Rik, PC2, TRPP2)
  • Promoter human U6
  • Tags / Fusion Proteins
    • 3XFLAG (N terminal on backbone)
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site SapI (destroyed during cloning)
  • 5′ sequencing primer agcgcgtgcgccaattctgcagacaaatggc
  • 3′ sequencing primer gccatttgtctgcagaattggcgcacgcgct
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCJ1023 was a gift from Bradley Yoder (Addgene plasmid # 228763 ; http://n2t.net/addgene:228763 ; RRID:Addgene_228763)