pBAD-HaloGFP-Na2.4
(Plasmid
#228470)
-
PurposeBacterial expression of green fluorescent sodium ion indicator HaloGFP-Na2.4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 228470 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBAD
- Backbone size w/o insert (bp) 4000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHaloGFP-Na2.4
-
SpeciesSynthetic
-
Insert Size (bp)1619
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (unknown if destroyed)
- 3′ cloning site Hind3 (unknown if destroyed)
- 5′ sequencing primer CTGTTTCTCCATACCCGTTTTTTGGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-HaloGFP-Na2.4 was a gift from Robert Campbell (Addgene plasmid # 228470 ; http://n2t.net/addgene:228470 ; RRID:Addgene_228470) -
For your References section:
A chemigenetic indicator based on a synthetic chelator and a green fluorescent protein for imaging of intracellular sodium ions. Takeuchi S, Imai S, Terai T, Campbell RE. RSC Chem Biol. 2024 Dec 3. doi: 10.1039/d4cb00256c. 10.1039/d4cb00256c PubMed 39678364