pBbAk-w4-loxP-TT-loxP-mCherry-PCB
(Plasmid #228469)

• Purpose: Fluorescent reporter for Cre recombinase activity and the PCB production gene. Cre removes a transcription terminator, leading to mCherry production
• Depositing Lab: Mary Dunlop
• Publication: Jafarbeglou et al ACS Synth Biol. 2024 Nov 19. doi: 10.1021/acssynbio.4c00388.

Backbone

• Vector backbone: pBbAk
• Backbone size w/o insert (bp): 2455
• Total vector size (bp): 5200
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: w4-loxP-TT-loxP-mCherry
• Species: Synthetic
• Insert Size (bp): 1051
• Promoter: T7A1

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: acgaggccctttgagTTATCAAAAAGAGTA

Gene/Insert 2

• Gene/Insert name: Ho1
• Species: Synthetic
• Insert Size (bp): 723
• Promoter: J23108

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: TAGTAAATCACTGCATAATTCGTGTCG

Gene/Insert 3

• Gene/Insert name: PcyA
• Species: Synthetic
• Insert Size (bp): 747
• Promoter: J23106

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: GGTGTTCAACAGCCTCACCC

Resource Information

• Supplemental Documents:
  • pBbAk-W4-loxP-TT-loxP-mCherry-PCB-GoldenGate.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry