pAAV-Ucp1-Cre-miR122
(Plasmid #228408)

• Purpose: Expression of Cre recombinase from a rat Ucp1 enhancer-promoter. Contains miR122 target sequences that suppress expression in hepatocytes.
• Depositing Lab: Joerg Heeren
• Publication: Behrens et al Mol Metab. 2024 Oct;88:101999. doi: 10.1016/j.molmet.2024.101999. Epub 2024 Jul 31.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-ucp1-Cre-3xmiR122-WPRE-HGHpA
• Backbone size w/o insert (bp): 5184
• Total vector size (bp): 5916
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: cre recombinase with SV40 NLS
• Species: Synthetic
• GenBank ID:
• Promoter: rat Ucp1 enhancer-promoter

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (unknown if destroyed)
• 3′ cloning site: KpnI (unknown if destroyed)
• 5′ sequencing primer: gtggctgccacagaagttcg
• 3′ sequencing primer: agctgacaggtggtggcaat

Gene/Insert 2

• Gene/Insert name: Cre recombinase with SV40 NLS
• Species: Synthetic

Resource Information

• Supplemental Documents:
  • Ucp1CremiR122 whole plasmid seq.gb
• A portion of this plasmid was derived from a plasmid made by: Ben Deverman (pAAV-CAG-Cre-3xmiR122-WPRE-HGHpA; Addgene plasmid # 183776).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry