pXR001-mCD4: EF1a-RfxCas13d-P2A-mCD4-T2A-EGFP
(Plasmid
#228359)
-
PurposeRfxCas13d (NLS-RfxCas13d-NLS) with 2A-EGFP and 2A-mCD4 for RNA knockdown
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 228359 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepXR001: EF1a-CasRx-2A-EGFP
- Total vector size (bp) 14341
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRfxCas13d
-
Alt nameCasRx
-
SpeciesH. sapiens (human); Ruminococcus flavefaciens
-
Insert Size (bp)3000
- Promoter EF1A
-
Tags
/ Fusion Proteins
- 2A-EGFP (C terminal on insert)
- 2A-mCD4 (C terminal on insert)
- NLS (N terminal on insert)
- NLS (C terminal on insert)
- HA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGATGTTCCAGATTACGCTGGATCCGGCGCAACAAACTTCTCTCTGCTGAAACAAGCCGGAGATGTCGAAGAGAATCCTGGACCGCCGGACATGTGCCGAGC
- 3′ sequencing primer GCCCTCTCCACTGCCGCCCTGGCGCTGTTGGTGCCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bymCD4 gene was amplified from the S. aureus Cas9 nuclease vector (Addgene #105998). pXR001 vector (Addgene #109049) was obtained from Addgene.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXR001-mCD4: EF1a-RfxCas13d-P2A-mCD4-T2A-EGFP was a gift from Michael Boettcher (Addgene plasmid # 228359 ; http://n2t.net/addgene:228359 ; RRID:Addgene_228359)