pHPHS232
(Plasmid #228356)

• Purpose: Landing pad with Bxb1 attP_wildtype site, Dox-inducible BFP-iCasp9-Blasticidin, CMV-driven rtTA3, T2A-neomycin for HDR into AAVS1 locus
• Depositing Lab: Arvind Rasi Subramaniam
• Publication: Nugent et al bioRxiv [Preprint]. 2024 Jul 26:2024.07.25.605204. doi: 10.1101/2024.07.25.605204.

Backbone

• Vector backbone: pAAVS1P-iCAG.copGFP
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418), Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mTagBFP2
• Species: Synthetic
• Promoter: TRE3GV
• Tags / Fusion Proteins:
  • iCasp9
  • Blasticidin S deaminase

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ctagtagccaggatgtc

Gene/Insert 2

• Gene/Insert name: Reverse tetracycline transactivator 3
• Alt name: rtTA3
• Species: Synthetic
• Promoter: TRE3GV

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AGGGAATCAGCATCGCTCATACTATATGGGGTAGGTGGGCCGGCCTT

Gene/Insert 3

• Gene/Insert name: neo
• Species: Synthetic
• Promoter: gene trap

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ctgacctcttctcttcctcccacagg

Resource Information

• Supplemental Documents:
  • pHPHS232_1_2_AAVS1P_pTet_BxB1-attP_BFP-iCasp9-Blast-rTTA3.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2024.07.25.605204 for bioRxiv preprint.