pADSS-EGFP
(Plasmid
#228197)
-
Purposeexpressed human ADSS with an EGFP fluorescent protein tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 228197 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4633
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameADSS
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1368
-
Entrez GeneADSS1 (a.k.a. ADSSL1, MPD5)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pADSS-EGFP was a gift from Stephen Benkovic (Addgene plasmid # 228197 ; http://n2t.net/addgene:228197 ; RRID:Addgene_228197) -
For your References section:
Quantitative analysis of purine nucleotides indicates that purinosomes increase de novo purine biosynthesis. Zhao H, Chiaro CR, Zhang L, Smith PB, Chan CY, Pedley AM, Pugh RJ, French JB, Patterson AD, Benkovic SJ. J Biol Chem. 2015 Mar 13;290(11):6705-13. doi: 10.1074/jbc.M114.628701. Epub 2015 Jan 20. 10.1074/jbc.M114.628701 PubMed 25605736