pHSP90(G97D)-mOFP
(Plasmid
#228195)
-
Purposeexpressed human Hsp90 (G97D mutation) with a mOFP fluorescent protein tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 228195 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepmOFP-N1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHSP90AA1(G97D)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2196
-
MutationG97D mutation
-
Entrez GeneHSP90AA1 (a.k.a. EL52, HEL-S-65p, HSP86, HSP89A, HSP90A, HSP90N, HSPC1, HSPCA, HSPCAL1, HSPCAL4, HSPN, Hsp103, Hsp89, Hsp90, LAP-2, LAP2)
- Promoter CMV
-
Tag
/ Fusion Protein
- mOFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHSP90(G97D)-mOFP was a gift from Stephen Benkovic (Addgene plasmid # 228195 ; http://n2t.net/addgene:228195 ; RRID:Addgene_228195) -
For your References section:
Hsp70/Hsp90 chaperone machinery is involved in the assembly of the purinosome. French JB, Zhao H, An S, Niessen S, Deng Y, Cravatt BF, Benkovic SJ. Proc Natl Acad Sci U S A. 2013 Feb 12;110(7):2528-33. doi: 10.1073/pnas.1300173110. Epub 2013 Jan 28. 10.1073/pnas.1300173110 PubMed 23359685