pBTL-2
(Plasmid #22806)

• Depositing Lab: Ryan Gill
• Publication: Lynch et al Biotechnol Bioeng. 2006 May 5. 94(1):151-8.

Backbone

• Vector backbone: pBTL-2
• Backbone size w/o insert (bp): 2618
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: None
• Insert Size (bp): 3847

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (unknown if destroyed)
• 3′ cloning site: EcoRV (unknown if destroyed)
• 5′ sequencing primer: gtgagcggataacaatttca

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry