pBTL-1
(Plasmid #22805)

• Purpose: (Empty Backbone)
• Depositing Lab: Ryan Gill
• Publication: Lynch et al Biotechnol Bioeng. 2006 May 5. 94(1):151-8.

Backbone

• Vector backbone: pBTL-1
• Backbone size (bp): 2662
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (unknown if destroyed)
• 3′ cloning site: EcoRV (unknown if destroyed)
• 5′ sequencing primer: AGCGGATAACAATTTCACACTCT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene's QC sequence shows a 1bp insertion with the author's provided sequence. The lab does not believe this affects the plasmid activity.