p155ME-loxP-dsR-loxP-Cas9-t2A-GFP
(Plasmid
#227774)
-
PurposeMiddle-entry vector with dsRed flanked by loxP sites and spCas9-GFP for Gateway cloning
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 227774 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMiddle entry Cas9-t2A-GFP
- Total vector size (bp) 8941
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameloxP-dsR-loxP
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1253
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AACGGCCACGAGTTCGAGATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p155ME-loxP-dsR-loxP-Cas9-t2A-GFP was a gift from Bushra Raj (Addgene plasmid # 227774 ; http://n2t.net/addgene:227774 ; RRID:Addgene_227774) -
For your References section:
Barcoding Notch signaling in the developing brain. Siniscalco AM, Perera RP, Greenslade JE, Veeravenkatasubramanian H, Masters A, Doll HM, Raj B. Development. 2024 Nov 22:dev.203102. doi: 10.1242/dev.203102. 10.1242/dev.203102 PubMed 39575683