pMH4-SYN-ChR2-tdimer2RFP
(Plasmid #22772)

• Depositing Lab: Thomas Oertner
• Publication: Zhang et al Proc Natl Acad Sci U S A. 2008 Aug 19. 105(33):12039-44.

Backbone

• Vector backbone: pMH4
• Backbone size w/o insert (bp): 7037
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: DH5alpha, JM109 high efficiency
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: ChR2-tdimer2RFP
• Species: mixture
• Insert Size (bp): 2330
• Tag / Fusion Protein:
  • ChR2-tdimer2RFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: SAlI (not destroyed)
• 5′ sequencing primer: gactcagcgctgcctcagtctg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Karl Deisseroth, Stanford; Roger Y. Tsien, San Diego

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

ChR2 seq.5'-3' 870-1796=926bp;
tdimer2RFP 5'-3' 1809-3200=1391bp