pDest-pol2-Smarcd1-Myc
(Plasmid
#227716)
-
PurposeExpresses mouse Smarcd1 protein with a Myc tag from a Pol2 promoter. Has a Blasticidin resistance gene for stable cell line generation and Ampicilin for plasmid propagation.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 227716 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDest
-
Backbone manufacturerDom Esposito
- Backbone size w/o insert (bp) 8600
- Total vector size (bp) 9700
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSmarcd1
-
Alt nameBaf60
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1500
-
GenBank IDNM_031842.2
-
Entrez GeneSmarcd1 (a.k.a. Baf60a, D15Kz1)
- Promoter pol2
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CACCATGGCGGCCCGGGCGGGTTT
- 3′ sequencing primer CTATGTGTTTCGGATTCCCAGGGCTTGCTCTAACTCTTGCCGCCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.01.24.577061 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDest-pol2-Smarcd1-Myc was a gift from Kent Hunter (Addgene plasmid # 227716 ; http://n2t.net/addgene:227716 ; RRID:Addgene_227716) -
For your References section:
SMARCD1 is an essential expression-restricted metastasis modifier. Ross C, Gong L-Y, Jenkins LM, Ha N-H, Majocha M, Hunter K. bioRxiv 2024.01.24.577061 10.1101/2024.01.24.577061