pICH47742::p35S-PE2max-NC::tEURb7
(Plasmid
#227693)
-
PurposeGolden Gate level 1, position 2, PE2max-NC expression cassette.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 227693 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepICH47742
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsThe depositing lab recommends using 10beta strain for expression.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePE2max-NC being driven by long CaMV 35S (p35S) and terminated by a dual terminator (EURb7).
-
SpeciesSynthetic
-
Insert Size (bp)9171
- Promoter CaMV 35S
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GGTGTAAACAAATTGACGCTTAGA
- 3′ sequencing primer CTCTTAGGTTTACCCGCCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICH47742::p35S-PE2max-NC::tEURb7 was a gift from Jae-Yean Kim (Addgene plasmid # 227693 ; http://n2t.net/addgene:227693 ; RRID:Addgene_227693) -
For your References section:
Optimized dicot prime editing enables heritable desired edits in tomato and Arabidopsis. Vu TV, Nguyen NT, Kim J, Song YJ, Nguyen TH, Kim JY. Nat Plants. 2024 Sep 6. doi: 10.1038/s41477-024-01786-w. 10.1038/s41477-024-01786-w PubMed 39242983