pLKO-1 shRev-Erbalpha
(Plasmid #22747)

• Depositing Lab: Bruce Spiegelman
• Publication: Estall et al Proc Natl Acad Sci U S A. 2009 Dec 29. 106(52):22510-5.

Backbone

• Vector backbone: pLKO.1
• Backbone manufacturer: Available at Addgene (#8453)
• Backbone size w/o insert (bp): 7000
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: shRev-Erbalpha
• Alt name: Rev-Erbalpha
• Alt name: Rev Erb alpha
• Species: M. musculus (mouse)
• Entrez Gene: Nr1d1 (a.k.a. A530070C09Rik)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: pLKO.1 5'

Resource Information

• Reference:
  • Addgene's pLKO.1 protocol
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

targeting sequence: GCGCTTTGCATCGTTGTTCAA