pBp-Control Sponge (CXCR4 sponge)
(Plasmid #22744)

• Purpose: (Empty Backbone)
• Depositing Lab: Bob Weinberg
• Publication: Valastyan et al Cell. 2009 Jun 12. 137(6):1032-46.

Backbone

• Vector backbone: pBABE-puro
• Backbone manufacturer: Weinberg lab (Addgene#:1764)
• Backbone size (bp): 5169
• Modifications to backbone: Non-targeting complementary sites (7x in tandem) to serve as a negative control for microRNA sponge-mediated inhibition of specific microRNA function; suitable for stable expression. Note that EGFP is also cloned into this backbone, upstream of the sponge.
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CXCR4 control sponge
• Alt name: stable control sponge
• Insert Size (bp): 2000

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: ApaI (unknown if destroyed)
• 5′ sequencing primer: pBabe-5
• 3′ sequencing primer: pBabe-3

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Subclond from CMV-CXCR4 control sponge, as described in Ebert et al. (Nature Methods, 2007)

Sequence of sponge: AAGUUUUCAGAAAGCUAACA