AAV-NG-CBE C
(Plasmid
#227422)
-
Purposeexpresses the C-terminal of AAV-NG-CBE
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 227422 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepx601
- Total vector size (bp) 7654
-
Modifications to backboneBackbone sourced from Addgene plasmid #137176
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAV-NG-CBE C-terminal
-
SpeciesSynthetic
- Promoter Cbh
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcaagaggtaagggtttaaggg
- 3′ sequencing primer U6 (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDavid Liu, backbone sourced from Addgene plasmid #137176.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-NG-CBE C was a gift from Yang Sun (Addgene plasmid # 227422 ; http://n2t.net/addgene:227422 ; RRID:Addgene_227422) -
For your References section:
Efficient Rescue of Retinal Degeneration in Pde6a Mice by Engineered Base Editing and Prime Editing. Liu Z, Chen S, Davis AE, Lo CH, Wang Q, Li T, Ning K, Zhang Q, Zhao J, Wang S, Sun Y. Adv Sci (Weinh). 2024 Sep 19:e2405628. doi: 10.1002/advs.202405628. 10.1002/advs.202405628 PubMed 39297417