pX330-PITCh-PXN
(Plasmid
#227315)
-
PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PXN for knock-in.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 227315 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneX330-BbsI-PITCh
-
Backbone manufacturerPeter Kaiser, Addgene #127875
- Backbone size w/o insert (bp) 8947
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesgRNA Targeting C-terminus of PXN
-
Alt namePXN
-
gRNA/shRNA sequenceCTTCCTCAAGCTCTTCTGCT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GenePXN
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCCTTTTTACGGTTCCTGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-PITCh-PXN was a gift from Laurence Pelletier (Addgene plasmid # 227315 ; http://n2t.net/addgene:227315 ; RRID:Addgene_227315) -
For your References section:
qTAG: an adaptable plasmid scaffold for CRISPR-based endogenous tagging. Philip R, Sharma A, Matellan L, Erpf AC, Hsu WH, Tkach JM, Wyatt HDM, Pelletier L. EMBO J. 2024 Dec 12. doi: 10.1038/s44318-024-00337-5. 10.1038/s44318-024-00337-5 PubMed 39668248