pX458-PLK4
(Plasmid
#227310)
-
PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of PLK4 for knock-in.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 227310 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX458
-
Backbone manufacturerFeng Zhang, Addgene #48138
- Backbone size w/o insert (bp) 9288
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesgRNA Targeting C-terminus of PLK4
-
Alt namePLK4
-
gRNA/shRNA sequenceAGTTTTAATCAATGAAAATT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
Entrez GenePLK4 (a.k.a. MCCRP2, SAK, STK18)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCCTTTTTACGGTTCCTGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX458-PLK4 was a gift from Laurence Pelletier (Addgene plasmid # 227310 ; http://n2t.net/addgene:227310 ; RRID:Addgene_227310) -
For your References section:
qTAG: An adaptable CRISPR-based endogenous tagging protocol using optimized repair cassettes. Philip R, Sharma A, Matellan L, Erpf AC, Hsu W, Tkach JM, Wyatt HDM, Pelletier L. bioRxiv 10.1101/2023.11.01.565029