qTAG-N-Solo-mStayGold-PCNT
(Plasmid
#227285)
-
PurposeDonor template for mStayGold insertion into the N-terminus of the PCNT locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PCNT (Addgene #227284)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 227285 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2686
-
Vector typeMammalian Expression, CRISPR ; Donor Template
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePCNT Homology Arms flanking a mStayGold Tag
-
Alt namePCNT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1874
-
Entrez GenePCNT (a.k.a. KEN, MOPD2, PCN, PCNT2, PCNTB, PCTN2, SCKL4)
- Promoter Promoterless
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTGCAAGGCGATTAAGTTGGGTAAC
- 3′ sequencing primer GGCTCGTATGTTGTGTGGAATTGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To be co-transfected with sgRNA plasmid px330-PCNT (Addgene #227284): https://www.addgene.org/227284/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
qTAG-N-Solo-mStayGold-PCNT was a gift from Laurence Pelletier (Addgene plasmid # 227285 ; http://n2t.net/addgene:227285 ; RRID:Addgene_227285) -
For your References section:
qTAG: an adaptable plasmid scaffold for CRISPR-based endogenous tagging. Philip R, Sharma A, Matellan L, Erpf AC, Hsu WH, Tkach JM, Wyatt HDM, Pelletier L. EMBO J. 2024 Dec 12. doi: 10.1038/s44318-024-00337-5. 10.1038/s44318-024-00337-5 PubMed 39668248