pPerimCh
(Plasmid
#227013)
-
PurposeExpresses periplasmic mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 227013 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFCcGi (Addgene #59324)
-
Backbone manufacturerSophie Helaine, David Holden
- Total vector size (bp) 7540
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)MG1655
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePelB-mCherry, arabinose inducible cytosolic GFP
-
SpeciesSynthetic
-
Insert Size (bp)3681
- Promoter rpsM and pBAD
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCGGCAAGACCCGTTCTAA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySophie Helaine & David Holden (Addgene plasmid # 59324) for the backbone plasmid.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPerimCh was a gift from Suzan Rooijakkers (Addgene plasmid # 227013 ; http://n2t.net/addgene:227013 ; RRID:Addgene_227013) -
For your References section:
Complement-dependent outer membrane perturbation sensitizes Gram-negative bacteria to Gram-positive specific antibiotics. Heesterbeek DAC, Martin NI, Velthuizen A, Duijst M, Ruyken M, Wubbolts R, Rooijakkers SHM, Bardoel BW. Sci Rep. 2019 Feb 28;9(1):3074. doi: 10.1038/s41598-019-38577-9. 10.1038/s41598-019-38577-9 PubMed 30816122