pAAV-CMVenh synapsin-intron-aSYNUCLEIN A53T
(Plasmid #227004)

• Purpose: AAV transfer plasmid encoding the human A53T mutant α-SYN under the control of the CMVie enhanced synapsin1 promoter
• Depositing Lab: Veerle Baekelandt
• Publication: Van der Perren et al J Vis Exp. 2016 Feb 28;(108):53670. doi: 10.3791/53670.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Wilson
• Backbone size w/o insert (bp): 4959
• Total vector size (bp): 5398
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: alpha synuclein A53T mutant
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 423
• Mutation: A53T
• Entrez Gene: SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
• Promoter: CMVenh synapsin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: GGTTACAAGACAGGTTTAAGGAG

Resource Information

• Supplemental Documents:
  • pAAV-TF-CMVie_synapsin-intron-synuclein-A53T.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry