Skip to main content
Addgene

PCR4-beta-globin::lacZ-H11
(Plasmid #227000)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 227000 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    PCR4-TOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size (bp) 3956
  • Vector type
    Mammalian Expression, Mouse Targeting, CRISPR
  • Promoter beta-globin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATCCTTCAGCTGCCCACTCTAC
  • 3′ sequencing primer ATGGGATAGGTCACGTTGGTGT
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Len Pennacchio (Addgene plasmid # 139098)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PCR4-beta-globin::lacZ-H11 was a gift from Guillaume Andrey (Addgene plasmid # 227000 ; http://n2t.net/addgene:227000 ; RRID:Addgene_227000)

  • For your References section:

    Pre-hypertrophic chondrogenic enhancer landscape of limb and axial skeleton development. Darbellay F, Ramisch A, Lopez-Delisle L, Kosicki M, Rauseo A, Jouini Z, Visel A, Andrey G. Nat Commun. 2024 Jun 6;15(1):4820. doi: 10.1038/s41467-024-49203-2. 10.1038/s41467-024-49203-2 PubMed 38844479
Related items: